Review



lentiviral constructs  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc lentiviral constructs
    Lentiviral Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral constructs/product/Addgene inc
    Average 94 stars, based on 68 article reviews
    lentiviral constructs - by Bioz Stars, 2026-04
    94/100 stars

    Images



    Similar Products

    94
    Addgene inc lentiviral constructs
    Lentiviral Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral constructs/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    lentiviral constructs - by Bioz Stars, 2026-04
    94/100 stars
      Buy from Supplier

    95
    Addgene inc plasmid encoding cd63 egfp
    Plasmid Encoding Cd63 Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid encoding cd63 egfp/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    plasmid encoding cd63 egfp - by Bioz Stars, 2026-04
    95/100 stars
      Buy from Supplier

    94
    Addgene inc expression vectors igg3
    Expression Vectors Igg3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expression vectors igg3/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    expression vectors igg3 - by Bioz Stars, 2026-04
    94/100 stars
      Buy from Supplier

    95
    Addgene inc egfp cd63
    sEVs from cholesterol‐depleted cells are more readily internalized. (A) Stably transfected HEK293T cells overexpressing mEmerald‐CD9 or <t>eGFP‐CD63.</t> Scale bar, 200 µm. (B) Experimental design for isolation of mEmerald‐CD9 and eGFP‐CD63 sEVs and quantitation of uptake by recipient cells. (C) Representative 3D reconstructions of target celluptake of mEmerald‐CD9 sEVs. Plasma membrane visualized with concanavalin A (ConA). Scale bar, 25 µm. (D) Representative images of target cells incubated with sEVs from cells treated with vehicle, simvastatin, or AY9944. Scale bar, 25 µm. (E) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 mEmerald‐CD9 sEVs (mean ± SEM; n = 21, 7 images analyzed from 3 independent experiments). Two‐way ANOVA (Interaction effect: F2,120 = 26.31, p < 0.0001; Treatment effect: F2,120 = 70.3, p < 0.0001; Dose effect: F1,120 = 152.1, p < 0.0001). Sidak's multiple comparisons test (** p ≤ 0.005, **** p < 0.0001). (F) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 eGFP‐CD63 sEVs (mean ± SEM; n = 12, 4 images analyzed from 3 independent experiments). Two‐way ANOVA (interaction effect: F2,66 = 5.633, p ≤ 0.0055; Treatment effect: F2,66 = 40.73, p < 0.0001; Dose effect: F1,66 = 58.16, p < 0.0001). Sidak's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.005, **** p < 0.0001).
    Egfp Cd63, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/egfp cd63/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    egfp cd63 - by Bioz Stars, 2026-04
    95/100 stars
      Buy from Supplier

    94
    Addgene inc gcagacatgataagatacattgatgagtt gonzalez
    sEVs from cholesterol‐depleted cells are more readily internalized. (A) Stably transfected HEK293T cells overexpressing mEmerald‐CD9 or <t>eGFP‐CD63.</t> Scale bar, 200 µm. (B) Experimental design for isolation of mEmerald‐CD9 and eGFP‐CD63 sEVs and quantitation of uptake by recipient cells. (C) Representative 3D reconstructions of target celluptake of mEmerald‐CD9 sEVs. Plasma membrane visualized with concanavalin A (ConA). Scale bar, 25 µm. (D) Representative images of target cells incubated with sEVs from cells treated with vehicle, simvastatin, or AY9944. Scale bar, 25 µm. (E) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 mEmerald‐CD9 sEVs (mean ± SEM; n = 21, 7 images analyzed from 3 independent experiments). Two‐way ANOVA (Interaction effect: F2,120 = 26.31, p < 0.0001; Treatment effect: F2,120 = 70.3, p < 0.0001; Dose effect: F1,120 = 152.1, p < 0.0001). Sidak's multiple comparisons test (** p ≤ 0.005, **** p < 0.0001). (F) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 eGFP‐CD63 sEVs (mean ± SEM; n = 12, 4 images analyzed from 3 independent experiments). Two‐way ANOVA (interaction effect: F2,66 = 5.633, p ≤ 0.0055; Treatment effect: F2,66 = 40.73, p < 0.0001; Dose effect: F1,66 = 58.16, p < 0.0001). Sidak's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.005, **** p < 0.0001).
    Gcagacatgataagatacattgatgagtt Gonzalez, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gcagacatgataagatacattgatgagtt gonzalez/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    gcagacatgataagatacattgatgagtt gonzalez - by Bioz Stars, 2026-04
    94/100 stars
      Buy from Supplier

    94
    Addgene inc agcaatagcatcacaaatttcacaa gonzalez
    sEVs from cholesterol‐depleted cells are more readily internalized. (A) Stably transfected HEK293T cells overexpressing mEmerald‐CD9 or <t>eGFP‐CD63.</t> Scale bar, 200 µm. (B) Experimental design for isolation of mEmerald‐CD9 and eGFP‐CD63 sEVs and quantitation of uptake by recipient cells. (C) Representative 3D reconstructions of target celluptake of mEmerald‐CD9 sEVs. Plasma membrane visualized with concanavalin A (ConA). Scale bar, 25 µm. (D) Representative images of target cells incubated with sEVs from cells treated with vehicle, simvastatin, or AY9944. Scale bar, 25 µm. (E) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 mEmerald‐CD9 sEVs (mean ± SEM; n = 21, 7 images analyzed from 3 independent experiments). Two‐way ANOVA (Interaction effect: F2,120 = 26.31, p < 0.0001; Treatment effect: F2,120 = 70.3, p < 0.0001; Dose effect: F1,120 = 152.1, p < 0.0001). Sidak's multiple comparisons test (** p ≤ 0.005, **** p < 0.0001). (F) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 eGFP‐CD63 sEVs (mean ± SEM; n = 12, 4 images analyzed from 3 independent experiments). Two‐way ANOVA (interaction effect: F2,66 = 5.633, p ≤ 0.0055; Treatment effect: F2,66 = 40.73, p < 0.0001; Dose effect: F1,66 = 58.16, p < 0.0001). Sidak's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.005, **** p < 0.0001).
    Agcaatagcatcacaaatttcacaa Gonzalez, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agcaatagcatcacaaatttcacaa gonzalez/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    agcaatagcatcacaaatttcacaa gonzalez - by Bioz Stars, 2026-04
    94/100 stars
      Buy from Supplier

    95
    Addgene inc addgene plasmid cd63 pegfp c2
    sEVs from cholesterol‐depleted cells are more readily internalized. (A) Stably transfected HEK293T cells overexpressing mEmerald‐CD9 or <t>eGFP‐CD63.</t> Scale bar, 200 µm. (B) Experimental design for isolation of mEmerald‐CD9 and eGFP‐CD63 sEVs and quantitation of uptake by recipient cells. (C) Representative 3D reconstructions of target celluptake of mEmerald‐CD9 sEVs. Plasma membrane visualized with concanavalin A (ConA). Scale bar, 25 µm. (D) Representative images of target cells incubated with sEVs from cells treated with vehicle, simvastatin, or AY9944. Scale bar, 25 µm. (E) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 mEmerald‐CD9 sEVs (mean ± SEM; n = 21, 7 images analyzed from 3 independent experiments). Two‐way ANOVA (Interaction effect: F2,120 = 26.31, p < 0.0001; Treatment effect: F2,120 = 70.3, p < 0.0001; Dose effect: F1,120 = 152.1, p < 0.0001). Sidak's multiple comparisons test (** p ≤ 0.005, **** p < 0.0001). (F) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 eGFP‐CD63 sEVs (mean ± SEM; n = 12, 4 images analyzed from 3 independent experiments). Two‐way ANOVA (interaction effect: F2,66 = 5.633, p ≤ 0.0055; Treatment effect: F2,66 = 40.73, p < 0.0001; Dose effect: F1,66 = 58.16, p < 0.0001). Sidak's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.005, **** p < 0.0001).
    Addgene Plasmid Cd63 Pegfp C2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/addgene plasmid cd63 pegfp c2/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    addgene plasmid cd63 pegfp c2 - by Bioz Stars, 2026-04
    95/100 stars
      Buy from Supplier

    94
    Addgene inc paav gfaab nature metabolism article
    sEVs from cholesterol‐depleted cells are more readily internalized. (A) Stably transfected HEK293T cells overexpressing mEmerald‐CD9 or <t>eGFP‐CD63.</t> Scale bar, 200 µm. (B) Experimental design for isolation of mEmerald‐CD9 and eGFP‐CD63 sEVs and quantitation of uptake by recipient cells. (C) Representative 3D reconstructions of target celluptake of mEmerald‐CD9 sEVs. Plasma membrane visualized with concanavalin A (ConA). Scale bar, 25 µm. (D) Representative images of target cells incubated with sEVs from cells treated with vehicle, simvastatin, or AY9944. Scale bar, 25 µm. (E) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 mEmerald‐CD9 sEVs (mean ± SEM; n = 21, 7 images analyzed from 3 independent experiments). Two‐way ANOVA (Interaction effect: F2,120 = 26.31, p < 0.0001; Treatment effect: F2,120 = 70.3, p < 0.0001; Dose effect: F1,120 = 152.1, p < 0.0001). Sidak's multiple comparisons test (** p ≤ 0.005, **** p < 0.0001). (F) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 eGFP‐CD63 sEVs (mean ± SEM; n = 12, 4 images analyzed from 3 independent experiments). Two‐way ANOVA (interaction effect: F2,66 = 5.633, p ≤ 0.0055; Treatment effect: F2,66 = 40.73, p < 0.0001; Dose effect: F1,66 = 58.16, p < 0.0001). Sidak's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.005, **** p < 0.0001).
    Paav Gfaab Nature Metabolism Article, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/paav gfaab nature metabolism article/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    paav gfaab nature metabolism article - by Bioz Stars, 2026-04
    94/100 stars
      Buy from Supplier

    95
    Addgene inc gfp cd63
    sEVs from cholesterol‐depleted cells are more readily internalized. (A) Stably transfected HEK293T cells overexpressing mEmerald‐CD9 or <t>eGFP‐CD63.</t> Scale bar, 200 µm. (B) Experimental design for isolation of mEmerald‐CD9 and eGFP‐CD63 sEVs and quantitation of uptake by recipient cells. (C) Representative 3D reconstructions of target celluptake of mEmerald‐CD9 sEVs. Plasma membrane visualized with concanavalin A (ConA). Scale bar, 25 µm. (D) Representative images of target cells incubated with sEVs from cells treated with vehicle, simvastatin, or AY9944. Scale bar, 25 µm. (E) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 mEmerald‐CD9 sEVs (mean ± SEM; n = 21, 7 images analyzed from 3 independent experiments). Two‐way ANOVA (Interaction effect: F2,120 = 26.31, p < 0.0001; Treatment effect: F2,120 = 70.3, p < 0.0001; Dose effect: F1,120 = 152.1, p < 0.0001). Sidak's multiple comparisons test (** p ≤ 0.005, **** p < 0.0001). (F) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 eGFP‐CD63 sEVs (mean ± SEM; n = 12, 4 images analyzed from 3 independent experiments). Two‐way ANOVA (interaction effect: F2,66 = 5.633, p ≤ 0.0055; Treatment effect: F2,66 = 40.73, p < 0.0001; Dose effect: F1,66 = 58.16, p < 0.0001). Sidak's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.005, **** p < 0.0001).
    Gfp Cd63, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp cd63/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    gfp cd63 - by Bioz Stars, 2026-04
    95/100 stars
      Buy from Supplier

    94
    Addgene inc nature cell biology article
    sEVs from cholesterol‐depleted cells are more readily internalized. (A) Stably transfected HEK293T cells overexpressing mEmerald‐CD9 or <t>eGFP‐CD63.</t> Scale bar, 200 µm. (B) Experimental design for isolation of mEmerald‐CD9 and eGFP‐CD63 sEVs and quantitation of uptake by recipient cells. (C) Representative 3D reconstructions of target celluptake of mEmerald‐CD9 sEVs. Plasma membrane visualized with concanavalin A (ConA). Scale bar, 25 µm. (D) Representative images of target cells incubated with sEVs from cells treated with vehicle, simvastatin, or AY9944. Scale bar, 25 µm. (E) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 mEmerald‐CD9 sEVs (mean ± SEM; n = 21, 7 images analyzed from 3 independent experiments). Two‐way ANOVA (Interaction effect: F2,120 = 26.31, p < 0.0001; Treatment effect: F2,120 = 70.3, p < 0.0001; Dose effect: F1,120 = 152.1, p < 0.0001). Sidak's multiple comparisons test (** p ≤ 0.005, **** p < 0.0001). (F) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 eGFP‐CD63 sEVs (mean ± SEM; n = 12, 4 images analyzed from 3 independent experiments). Two‐way ANOVA (interaction effect: F2,66 = 5.633, p ≤ 0.0055; Treatment effect: F2,66 = 40.73, p < 0.0001; Dose effect: F1,66 = 58.16, p < 0.0001). Sidak's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.005, **** p < 0.0001).
    Nature Cell Biology Article, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nature cell biology article/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    nature cell biology article - by Bioz Stars, 2026-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    sEVs from cholesterol‐depleted cells are more readily internalized. (A) Stably transfected HEK293T cells overexpressing mEmerald‐CD9 or eGFP‐CD63. Scale bar, 200 µm. (B) Experimental design for isolation of mEmerald‐CD9 and eGFP‐CD63 sEVs and quantitation of uptake by recipient cells. (C) Representative 3D reconstructions of target celluptake of mEmerald‐CD9 sEVs. Plasma membrane visualized with concanavalin A (ConA). Scale bar, 25 µm. (D) Representative images of target cells incubated with sEVs from cells treated with vehicle, simvastatin, or AY9944. Scale bar, 25 µm. (E) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 mEmerald‐CD9 sEVs (mean ± SEM; n = 21, 7 images analyzed from 3 independent experiments). Two‐way ANOVA (Interaction effect: F2,120 = 26.31, p < 0.0001; Treatment effect: F2,120 = 70.3, p < 0.0001; Dose effect: F1,120 = 152.1, p < 0.0001). Sidak's multiple comparisons test (** p ≤ 0.005, **** p < 0.0001). (F) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 eGFP‐CD63 sEVs (mean ± SEM; n = 12, 4 images analyzed from 3 independent experiments). Two‐way ANOVA (interaction effect: F2,66 = 5.633, p ≤ 0.0055; Treatment effect: F2,66 = 40.73, p < 0.0001; Dose effect: F1,66 = 58.16, p < 0.0001). Sidak's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.005, **** p < 0.0001).

    Journal: Journal of Extracellular Vesicles

    Article Title: Cholesterol Deficiency Directs Autophagy‐Dependent Secretion of Extracellular Vesicles

    doi: 10.1002/jev2.70218

    Figure Lengend Snippet: sEVs from cholesterol‐depleted cells are more readily internalized. (A) Stably transfected HEK293T cells overexpressing mEmerald‐CD9 or eGFP‐CD63. Scale bar, 200 µm. (B) Experimental design for isolation of mEmerald‐CD9 and eGFP‐CD63 sEVs and quantitation of uptake by recipient cells. (C) Representative 3D reconstructions of target celluptake of mEmerald‐CD9 sEVs. Plasma membrane visualized with concanavalin A (ConA). Scale bar, 25 µm. (D) Representative images of target cells incubated with sEVs from cells treated with vehicle, simvastatin, or AY9944. Scale bar, 25 µm. (E) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 mEmerald‐CD9 sEVs (mean ± SEM; n = 21, 7 images analyzed from 3 independent experiments). Two‐way ANOVA (Interaction effect: F2,120 = 26.31, p < 0.0001; Treatment effect: F2,120 = 70.3, p < 0.0001; Dose effect: F1,120 = 152.1, p < 0.0001). Sidak's multiple comparisons test (** p ≤ 0.005, **** p < 0.0001). (F) Quantified uptake in recipient cells exposed to 1 × 10 8 or 2.5 × 10 8 eGFP‐CD63 sEVs (mean ± SEM; n = 12, 4 images analyzed from 3 independent experiments). Two‐way ANOVA (interaction effect: F2,66 = 5.633, p ≤ 0.0055; Treatment effect: F2,66 = 40.73, p < 0.0001; Dose effect: F1,66 = 58.16, p < 0.0001). Sidak's multiple comparisons test (* p ≤ 0.05, ** p ≤ 0.005, **** p < 0.0001).

    Article Snippet: Plasmids housing genes for proteins involved in sEV biogenesis or mature autophagosome formation fused to fluorescent reporters, including mEmerald‐CD9 (a gift from Michael Davidson, Addgene plasmid # 54029), eGFP‐CD63 (a gift from Paul Luzio, Addgene plasmid # 62964) and mCherry‐LC3B (a gift from David Rubinsztein, Addgene plasmid # 40827), were isolated and purified (GeneJET Plasmid Maxiprep Kit, Cat. # K0491).

    Techniques: Stable Transfection, Transfection, Isolation, Quantitation Assay, Clinical Proteomics, Membrane, Incubation